ricA [2018-03-08 16:35:40]

subunit of the regulatory iron-sulfur containing YmcA-YlbF-YaaT complex, antagonist of biofilm repression by SinR, control of the phosphorelay

Locus: BSU17020

Isoelectric point: 5.09

Molecular weight: 16.02 kDa

Protein length: 143 aa

Gene length: 429 bp

Function: control of biofilm formation and the phosphorelay

Product: subunit of the regulatory iron-sulfur containing YmcA-YlbF-YaaT complex

Essential: no

Synonyms: ymcA

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → RNA synthesis and degradation → RNases → Effectors of RNA degradation
• Information processing → Regulation of gene expression → Transcription factors and their control → Control of transcription factor (other than two-component system)
• Information processing → Regulation of gene expression → phosphorelay → Other protein controlling the activity of the phosphorelay
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Other proteins required for biofilm formation
• Lifestyles → Sporulation → phosphorelay → Other protein controlling the activity of the phosphorelay

Gene

Coordinates: 1,774,374 → 1,774,805

Phenotypes of a mutant

• strongly reduced genetic competence, strongly reduced sporulation PubMed

The protein

Catalyzed reaction/ biological activity

• the YmcA-YlbF-YaaT complex stimulates Spo0A phosphorylation in the phosphorelay PubMed

Structure

• 2PIH

Localization

• cytoplasm PubMed

Expression and Regulation

Operons

• Genes: ymcB-ymcA
  Description: PubMed

Biological materials

Mutant

• BKE17020 (ΔymcA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GTCTTTTTTTGAGTAGAGCG, downstream forward: _UP4_TAAACACGGTGCCTTTACAG
• BKK17020 (ΔymcA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GTCTTTTTTTGAGTAGAGCG, downstream forward: _UP4_TAAACACGGTGCCTTTACAG

References

Loading